Venn’s diagram of lncRNAs that were significantly differentially expressed using microarray screening of lncRNAs involved in epigenetic mechanisms and/or pathways. (A) Number of lncRNAs in regard to the number of subtypes in which they were found differentially expressed (the number of subtypes rises from the outer circle (one subtype) towards the inner one (four subtypes)). (B) The number of lncRNAs found differentially expressed in all four analysed subtypes (using two levels of stringency – absolute fold change cut-off value of 1.5 and (2)).
Figure 2
(A) Differential expression of LOC285758 in individual samples (y-axis presents ΔΔCT values). (B) Comparison of average ΔΔCT values for individual glioma subtype, determined by microarray and qPCR. Oligoastrocytoma samples were not included in microarray analysis. ΔΔCT represents difference of gene’s expression in comparison to brain reference RNA, and the positive values mean that gene’s levels are increased. p-values were determined for qPCR data (ANOVA for comparing all five subtypes and Mann-Whitney U-test for comparing two subtypes).
Figure 3
Scatter plots showing (A)LOC285758 expression (qPCR) in association to methylation status. Unmethylated samples showed higher expression levels compared to methylated ones. (B)LOC285758 expression and promoter methylation status significantly differ regarding the WHO malignancy grade and (C) glioma subtype, especially comparing astrocytoma grade I-III (all samples were methylated) to grade IV (GBMs were largely unmethylated).Promoter methylation: 0 = unmethylated, 1 = methylated
Association of LOC285758 expression with patients demographic data and glioma hallmark biomarkers: mutations of IDH1 and TP53, copy number variations of CDKN2A and CDKN2B, and loss of chromosome arm 1p and 19q (1p/19q co-deletion)
LOC285758 expression
LOC285758 promoter methylation
rs
p-value
rs
p-value
Gender
-0.044
0.634
0.009
0.920
Age at diagnosis (< 45y >)
0.065
0.475
-0.313
< 0.001
WHO grade (low/high)
0.213
0.019
-0.433
< 0.001
IDH1 (wt/mut)
0.375
< 0.001
0.096
0.331
TP53(wt/mut)
-0.083
0.483
0.153
0.178
1p loss (wt/del)
0.310
0.005
-0.396
< 0.001
19q loss (wt/del)
0.267
0.032
-0.360
0.002
1p/19q loss (wt/del)
0.262
0.014
-0.373
< 0.001
CDKN2A (wt/del)
0.085
0.477
-0.231
0.042
CDKN2B (wt/del)
0.093
0.435
-0.240
0.033
Patients’ demographics and glioma histopathological classification
Patients demographic
Number of patients
157
Gender (female/male)
67/90 (1 : 1.34)
Mean age at diagnosis (years)
43.8 (SD ±18,89)
# < 45 years
86
# > 45 years
71
Glioma classification
Glioma subtype
WHO grade
Astrocytoma (AC)
15 pilocytic
WHO I
9 diffuse
WHO II
11 diffuse with signs of anaplasia
WHO II-III
9 anaplastic
WHO III
23 secondary GBM
WHO IV
31 primary GBM
WHO IV
Oligodendroglioma (ODG)
4 diffuse
WHO II
5 diffuse with signs of anaplasia
WHO II-III
28 anaplastic
WHO III
Oligoastrocytoma (OAC)
2 diffuse
WHO II
3 diffuse with signs of anaplasia
WHO II-III
17 anaplastic
WHO III
Primers used for validation of LOC285758 expression profiling results, reference genes and determining methylation status of lncRNA’s promoter
Quantitative real-time PCR
Gene
Assay ID
Amplicon length (bp)
Annealing temperature (°C)
LOC285758
Hs.PT.58.26012748
129
60
GAPDH
QT00079247
95
55
Gene
Primer sequence (5’ - 3’)
Amplicon length (bp)
Annealing temperature (°C)
U6
CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
94
60
Methylation sensitive HRM
Gene
Oligonucleotide sequence (5’ – 3’)
Amplicon length (bp)
Annealing temperature (°C)
LOC285758 F
TTGTTTTTTGAAAGTTTTTTGA
118
55
LOC285758 R
AAACACAAAAAACCTAACAAAAA
Top 10 lncRNAs that showed significantly increased/decreased expression in four glioma subtypes, using the LncPath Human Epigenetic Pathway microarray (ArrayStar, USA)
Astrocytoma II+III
II+III – tumours of WHO grade II and III; (abs) = absolute value; FC = fold change
Louis DN, Molecular pathology of malignant gliomas. Annu Rev Pathol 2006; 1: 97-117. 10.1146/annurev.pathol.1.110304.100043LouisDN,Molecular pathology of malignant gliomasAnnu Rev Pathol200619711710.1146/annurev.pathol.1.110304.100043Open DOISearch in Google Scholar
Mesti T, Moltara ME, Boc M, Rebersek M,Ocvirk J, Bevacizumab and irinotecan in recurrent malignant glioma, a single institution experience. Radiol Oncol 2015; 49: 80-5. 10.2478/raon-2014-0021MestiT,MoltaraME,BocM,RebersekM,OcvirkJ,Bevacizumab and irinotecan in recurrent malignant glioma, a single institution experienceRadiol Oncol20154980510.2478/raon-2014-0021Open DOISearch in Google Scholar
Qureshi IA, Mattick JS,Mehler MF, Long non-coding RNAs in nervous system function and disease. Brain Res 2010; 1338: 20-35. 10.1016/j.brain-res.2010.03.110QureshiIA,MattickJS,MehlerMF,Long non-coding RNAs in nervous system function and diseaseBrain Res20101338203510.1016/j.brain-res.2010.03.110Open DOISearch in Google Scholar
Gibb EA, Vucic EA, Enfield KS, Stewart GL, Lonergan KM, Kennett JY, et al., Human cancer long non-coding RNA transcriptomes. PLoS One 2011; 6: e25915. 10.1371/journal.pone.0025915GibbEA,VucicEA,EnfieldKS,StewartGL,LonerganKM,KennettJY,et alHuman cancer long non-coding RNA transcriptomesPLoS One20116e2591510.1371/journal.pone.0025915Open DOISearch in Google Scholar
Qureshi IA,Mehler MF, Emerging roles of non-coding RNAs in brain evolution, development, plasticity and disease. Nat Rev Neurosci 2012; 13: 528-41. 10.1038/nrn3234QureshiIA,MehlerMF,Emerging roles of non-coding RNAs in brain evolution, development, plasticity and diseaseNat Rev Neurosci2012135284110.1038/nrn3234Open DOISearch in Google Scholar
Zhang X, Sun S, Pu JK, Tsang AC, Lee D, Man VO, et al., Long non-coding RNA expression profiles predict clinical phenotypes in glioma. Neurobiol Dis 2012; 48: 1-8. 10.1016/j.nbd.2012.06.004ZhangX,SunS,PuJK,TsangAC,LeeD,ManVO,et alLong non-coding RNA expression profiles predict clinical phenotypes in gliomaNeurobiol Dis2012481810.1016/j.nbd.2012.06.004Open DOISearch in Google Scholar
Gibb EA, Brown CJ,Lam WL, The functional role of long non-coding RNA in human carcinomas. Mol Cancer 2011; 10: 38. 10.1186/1476-4598-10-38GibbEA,BrownCJ,LamWL,The functional role of long non-coding RNA in human carcinomasMol Cancer2011103810.1186/1476-4598-10-38Open DOISearch in Google Scholar
Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, et al., Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 2009; 458: 223-7. 10.1038/nature07672GuttmanM,AmitI,GarberM,FrenchC,LinMF,FeldserD,et alChromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammalsNature2009458223710.1038/nature07672Open DOISearch in Google Scholar
Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, et al., Landscape of transcription in human cells. Nature 2012; 489: 101-8. 10.1038/nature11233DjebaliS,DavisCA,MerkelA,DobinA,LassmannT,MortazaviA,et alLandscape of transcription in human cellsNature2012489101810.1038/nature11233Open DOISearch in Google Scholar
Weichenhan D,Plass C, The evolving epigenome. Hum Mol Genet 2013; 22: R1-6. 10.1093/hmg/ddt348WeichenhanD,PlassC,The evolving epigenomeHum Mol Genet201322R1610.1093/hmg/ddt348Open DOISearch in Google Scholar
Hassler MR,Egger G, Epigenomics of cancer - emerging new concepts. Biochimie 2012; 94: 2219-30. 10.1016/j.biochi.2012.05.007HasslerMR,EggerG,Epigenomics of cancer - emerging new conceptsBiochimie20129422193010.1016/j.biochi.2012.05.007Open DOISearch in Google Scholar
Tripathi V, Shen Z, Chakraborty A, Giri S, Freier SM, Wu X, et al., Long noncoding RNA MALAT1 controls cell cycle progression by regulating the expression of oncogenic transcription factor B-MYB. PLoS Genet 2013; 9: e1003368. 10.1371/journal.pgen.1003368TripathiV,ShenZ,ChakrabortyA,GiriS,FreierSM,WuX,et alLong noncoding RNA MALAT1 controls cell cycle progression by regulating the expression of oncogenic transcription factor B-MYBPLoS Genet20139e100336810.1371/journal.pgen.1003368Open DOISearch in Google Scholar
Tian D, Sun S,Lee JT, The long noncoding RNA, Jpx, is a molecular switch for X chromosome inactivation. Cell 2010; 143: 390-403. 10.1016/j.cell.2010.09.049TianD,SunS,LeeJT,The long noncoding RNA, Jpx, is a molecular switch for X chromosome inactivationCell201014339040310.1016/j.cell.2010.09.049Open DOISearch in Google Scholar
Lee C,Kikyo N, Strategies to identify long noncoding RNAs involved in gene regulation. Cell Biosci 2012; 2: 37. 10.1186/2045-3701-2-37LeeC,KikyoN,Strategies to identify long noncoding RNAs involved in gene regulationCell Biosci201223710.1186/2045-3701-2-37Open DOISearch in Google Scholar
Kitagawa M, Kitagawa K, Kotake Y, Niida H,Ohhata T, Cell cycle regulation by long non-coding RNAs. Cell Mol Life Sci 2013; 70: 4785-94. 10.1007/s00018-013-1423-0KitagawaM,KitagawaK,KotakeY,NiidaH,OhhataT,Cell cycle regulation by long non-coding RNAsCell Mol Life Sci20137047859410.1007/s00018-013-1423-0Open DOISearch in Google Scholar
Han L, Zhang K, Shi Z, Zhang J, Zhu J, Zhu S, et al., LncRNA profile of glioblastoma reveals the potential role of lncRNAs in contributing to glioblastoma pathogenesis. Int J Oncol 2012; 40: 2004-12. 10.3892/ijo.2012.1413HanL,ZhangK,ShiZ,ZhangJ,ZhuJ,ZhuS,et alLncRNA profile of glioblastoma reveals the potential role of lncRNAs in contributing to glioblastoma pathogenesisInt J Oncol20124020041210.3892/ijo.2012.1413Open DOISearch in Google Scholar
Mercer TR,Mattick JS, Structure and function of long noncoding RNAs in epigenetic regulation. Nat Struct Mol Biol 2013; 20: 300-7. 10.1038/nsmb.2480MercerTR,MattickJS,Structure and function of long noncoding RNAs in epigenetic regulationNat Struct Mol Biol201320300710.1038/nsmb.2480Open DOISearch in Google Scholar
Karapetyan AR, Buiting C, Kuiper RA,Coolen MW, Regulatory Roles for Long ncRNA and mRNA. Cancers (Basel) 2013; 5: 462-90. 10.3390/cancers5020462KarapetyanAR,BuitingC,KuiperRA,CoolenMW,Regulatory Roles for Long ncRNA and mRNACancers (Basel)201354629010.3390/cancers5020462Open DOISearch in Google Scholar
Kanduri C, Long noncoding RNAs: Lessons from genomic imprinting. Biochim Biophys Acta 2016; 1859: 102-11. 10.1016/j.bbagrm.2015.05.006KanduriC,Long noncoding RNAs: Lessons from genomic imprintingBiochim Biophys Acta201618591021110.1016/j.bbagrm.2015.05.006Open DOISearch in Google Scholar
Fietkau R, Putz F, Lahmer G, Semrau S,Buslei R, Can MGMT promoter methylation status be used as a prognostic and predictive marker for glioblastoma multiforme at the present time? A word of caution. Strahlenther Onkol 2013; 189: 993-5. 10.1007/s00066-013-0459-2FietkauR,PutzF,LahmerG,SemrauS,BusleiR,Can MGMT promoter methylation status be used as a prognostic and predictive marker for glioblastoma multiforme at the present time? A word of cautionStrahlenther Onkol2013189993510.1007/s00066-013-0459-2Open DOISearch in Google Scholar
Smrdel U, Popovic M, Zwitter M, Bostjancic E, Zupan A, Kovac V, et al., Longterm survival in glioblastoma: methyl guanine methyl transferase (MGMT) promoter methylation as independent favourable prognostic factor, in Radiol Oncol 2016; 50: 394-401. 10.1515/raon-2015-0041SmrdelU,PopovicM,ZwitterM,BostjancicE,ZupanA,KovacV,et alLongterm survival in glioblastoma: methyl guanine methyl transferase (MGMT) promoter methylation as independent favourable prognostic factorin Radiol Oncol20165039440110.1515/raon-2015-0041Open DOISearch in Google Scholar
Shi X, Sun M, Liu H, Yao Y,Song Y, Long non-coding RNAs: a new frontier in the study of human diseases. Cancer Lett 2013; 339: 159-66. 10.1016/j.canlet.2013.06.013ShiX,SunM,LiuH,YaoY,SongY,Long non-coding RNAs: a new frontier in the study of human diseasesCancer Lett20133391596610.1016/j.canlet.2013.06.013Open DOISearch in Google Scholar
Bian EB, Li J, Xie YS, Zong G,Zhao B, LncRNAs: New Players in Gliomas, with Special Emphasis on the Interaction of lncRNAs With EZH2. J Cell Physiol 2015; 230: 496-503. 10.1002/jcp.24549BianEB,LiJ,XieYS,ZongG,ZhaoB,LncRNAs: New Players in Gliomas, with Special Emphasis on the Interaction of lncRNAs With EZH2J Cell Physiol201523049650310.1002/jcp.24549Open DOISearch in Google Scholar
Alelu-Paz R, Ashour N, Gonzalez-Corpas A,Ropero S, DNA methylation, histone modifications, and signal transduction pathways: a close relationship in malignant gliomas pathophysiology. J Signal Transduct 2012; 2012: 956958. 10.1155/2012/956958Alelu-PazR,AshourN,Gonzalez-CorpasA,RoperoS,DNA methylation, histone modifications, and signal transduction pathways: a close relationship in malignant gliomas pathophysiologyJ Signal Transduct2012201295695810.1155/2012/956958Open DOISearch in Google Scholar
Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, et al., The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol 2007; 114: 97-109. 10.1007/s00401-007-0243-4LouisDN,OhgakiH,WiestlerOD,CaveneeWK,BurgerPC,JouvetA,et alThe 2007 WHO classification of tumours of the central nervous systemActa Neuropathol20071149710910.1007/s00401-007-0243-4Open DOISearch in Google Scholar
Livak KJ,Schmittgen TD, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: 402-8. 10.1006/meth.2001.1262LivakKJ,SchmittgenTD,Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) MethodMethods200125402810.1006/meth.2001.1262Open DOISearch in Google Scholar
Li J, Bian EB, He XJ, Ma CC, Zong G, Wang HL, et al., Epigenetic repression of long non-coding RNA MEG3 mediated by DNMT1 represses the p53 pathway in gliomas. Int J Oncol 2016; 48: 723-33. 10.3892/ijo.2015.3285LiJ,BianEB,HeXJ,MaCC,ZongG,WangHL,et alEpigenetic repression of long non-coding RNA MEG3 mediated by DNMT1 represses the p53 pathway in gliomasInt J Oncol2016487233310.3892/ijo.2015.3285Open DOISearch in Google Scholar
Wang P, Ren Z,Sun P, Overexpression of the long non-coding RNA MEG3 impairs in vitro glioma cell proliferation. J Cell Biochem 2012; 113: 1868-74. 10.1002/jcb.24055WangP,RenZ,SunP,Overexpression of the long non-coding RNA MEG3 impairs in vitro glioma cell proliferationJ Cell Biochem201211318687410.1002/jcb.24055Open DOISearch in Google Scholar
Park JY, Lee JE, Park JB, Yoo H, Lee SH,Kim JH, Roles of Long Non-Coding RNAs on Tumorigenesis and Glioma Development. Brain Tumor Res Treat 2014; 2: 1-6. 10.14791/btrt.2014.2.1.1ParkJY,LeeJE,ParkJB,YooH,LeeSH,KimJH,Roles of Long Non-Coding RNAs on Tumorigenesis and Glioma DevelopmentBrain Tumor Res Treat201421610.14791/btrt.2014.2.1.1Open DOISearch in Google Scholar
Yao Y, Ma J, Xue Y, Wang P, Li Z, Liu J, et al., Knockdown of long non-coding RNA XIST exerts tumor-suppressive functions in human glioblastoma stem cells by up-regulating miR-152. Cancer Lett 2015; 359: 75-86. 10.1016/j.canlet.2014.12.051YaoY,MaJ,XueY,WangP,LiZ,LiuJ,et alKnockdown of long non-coding RNA XIST exerts tumor-suppressive functions in human glioblastoma stem cells by up-regulating miR-152Cancer Lett2015359758610.1016/j.canlet.2014.12.051Open DOISearch in Google Scholar
He C, Jiang B, Ma J,Li Q, Aberrant NEAT1 expression is associated with clinical outcome in high grade glioma patients. Apmis 2016; 124: 169-74. 10.1111/apm.12480HeC,JiangB,MaJ,LiQ,Aberrant NEAT1 expression is associated with clinical outcome in high grade glioma patientsApmis20161241697410.1111/apm.12480Open DOISearch in Google Scholar
Wang Q, Zhang J, Liu Y, Zhang W, Zhou J, Duan R, et al., A novel cell cycleassociated lncRNA, HOXA11-AS, is transcribed from the 5-prime end of the HOXA transcript and is a biomarker of progression in glioma. Cancer Lett 2016; 373: 251-9. 10.1016/j.canlet.2016.01.039WangQ,ZhangJ,LiuY,ZhangW,ZhouJ,DuanR,et alA novel cell cycleassociated lncRNA, HOXA11-AS, is transcribed from the 5-prime end of the HOXA transcript and is a biomarker of progression in gliomaCancer Lett2016373251910.1016/j.canlet.2016.01.039Open DOISearch in Google Scholar
Ohgaki H,Kleihues P, The definition of primary and secondary glioblastoma. Clin Cancer Res 2013; 19: 764-72. 10.1158/1078-0432.ccr-12-3002OhgakiH,KleihuesP,The definition of primary and secondary glioblastomaClin Cancer Res2013197647210.1158/1078-0432.ccr-12-3002Open DOISearch in Google Scholar
Wojdacz TK,Dobrovic A, Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res 2007; 35: e41. 10.1093/nar/gkm013WojdaczTK,DobrovicA,Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylationNucleic Acids Res200735e4110.1093/nar/gkm013Open DOISearch in Google Scholar
Switzeny OJ, Christmann M, Renovanz M, Giese A, Sommer C,Kaina B, MGMT promoter methylation determined by HRM in comparison to MSP and pyrosequencing for predicting high-grade glioma response. Clin Epigenetics 2016; 8: 49. 10.1186/s13148-016-0204-7SwitzenyOJ,ChristmannM,RenovanzM,GieseA,SommerC,KainaB,MGMT promoter methylation determined by HRM in comparison to MSP and pyrosequencing for predicting high-grade glioma responseClin Epigenetics201684910.1186/s13148-016-0204-7Open DOISearch in Google Scholar
Hagedorn M, Siegfried G, Hooks KB,Khatib AM, Integration of zebrafish fin regeneration genes with expression data of human tumors in silico uncovers potential novel melanoma markers. Oncotarget 2016; 7: 71567-71579. 10.18632/oncotarget.12257HagedornM,SiegfriedG,HooksKB,KhatibAM,Integration of zebrafish fin regeneration genes with expression data of human tumors in silico uncovers potential novel melanoma markersOncotarget20167715677157910.18632/oncotarget.12257Open DOISearch in Google Scholar
Legendre CR, Demeure MJ, Whitsett TG, Gooden GC, Bussey KJ, Jung S, et al., Pathway Implications of Aberrant Global Methylation in Adrenocortical Cancer. PLoS One 2016; 11: e0150629. 10.1371/journal.pone.0150629LegendreCR,DemeureMJ,WhitsettTG,GoodenGC,BusseyKJ,JungS,et alPathway Implications of Aberrant Global Methylation in Adrenocortical CancerPLoS One201611e015062910.1371/journal.pone.0150629Open DOISearch in Google Scholar
Yang Z, Xu S, Jin P, Yang X, Li X, Wan D, et al., MARCKS contributes to stromal cancer-associated fibroblast activation and facilitates ovarian cancer metastasis. Oncotarget 2016; 7: 37649-37663. 10.18632/oncotarget.8726YangZ,XuS,JinP,YangX,LiX,WanD,et alMARCKS contributes to stromal cancer-associated fibroblast activation and facilitates ovarian cancer metastasisOncotarget20167376493766310.18632/oncotarget.8726Open DOISearch in Google Scholar
Micallef J, Taccone M, Mukherjee J, Croul S, Busby J, Moran MF, et al., Epidermal growth factor receptor variant III-induced glioma invasion is mediated through myristoylated alanine-rich protein kinase C substrate overexpression. Cancer Res 2009; 69: 7548-56. 10.1158/0008-5472.can-08-4783MicallefJ,TacconeM,MukherjeeJ,CroulS,BusbyJ,MoranMF,et alEpidermal growth factor receptor variant III-induced glioma invasion is mediated through myristoylated alanine-rich protein kinase C substrate overexpressionCancer Res20096975485610.1158/0008-5472.can-08-4783Open DOISearch in Google Scholar
Rohrbach TD, Shah N, Jackson WP, Feeney EV, Scanlon S, Gish R, et al., The Effector Domain of MARCKS Is a Nuclear Localization Signal that Regulates Cellular PIP2 Levels and Nuclear PIP2 Localization. PLoS One 2015; 10: e0140870. 10.1371/journal.pone.0140870RohrbachTD,ShahN,JacksonWP,FeeneyEV,ScanlonS,GishR,et alThe Effector Domain of MARCKS Is a Nuclear Localization Signal that Regulates Cellular PIP2 Levels and Nuclear PIP2 LocalizationPLoS One201510e014087010.1371/journal.pone.0140870Open DOISearch in Google Scholar
Rohrbach TD, Jarboe JS, Anderson JC, Trummell HQ, Hicks PH, Weaver AN, et al., Targeting the effector domain of the myristoylated alanine rich C-kinase substrate enhances lung cancer radiation sensitivity. Int J Oncol 2015; 46: 1079-88. 10.3892/ijo.2014.2799RohrbachTD,JarboeJS,AndersonJC,TrummellHQ,HicksPH,WeaverAN,et alTargeting the effector domain of the myristoylated alanine rich C-kinase substrate enhances lung cancer radiation sensitivityInt J Oncol20154610798810.3892/ijo.2014.2799Open DOISearch in Google Scholar
Hanada S, Kakehashi A, Nishiyama N, Wei M, Yamano S, Chung K, et al., Myristoylated alanine-rich C-kinase substrate as a prognostic biomarker in human primary lung squamous cell carcinoma. Cancer Biomark 2013; 13: 289-98. 10.3233/cbm-130354HanadaS,KakehashiA,NishiyamaN,WeiM,YamanoS,ChungK,et alMyristoylated alanine-rich C-kinase substrate as a prognostic biomarker in human primary lung squamous cell carcinomaCancer Biomark2013132899810.3233/cbm-130354Open DOISearch in Google Scholar
Punzi G, Ursini G, Shin JH, Kleinman JE, Hyde TM,Weinberger DR, Increased expression of MARCKS in post-mortem brain of violent suicide completers is related to transcription of a long, noncoding, antisense RNA. Mol Psychiatry 2014; 19: 1057-9. 10.1038/mp.2014.41PunziG,UrsiniG,ShinJH,KleinmanJE,HydeTM,WeinbergerDR,Increased expression of MARCKS in post-mortem brain of violent suicide completers is related to transcription of a long, noncoding, antisense RNAMol Psychiatry2014191057910.1038/mp.2014.41Open DOISearch in Google Scholar
Ropero S,Esteller M, The role of histone deacetylases (HDACs) in human cancer. Mol Oncol 2007; 1: 19-25. 10.1016/j.molonc.2007.01.001RoperoS,EstellerM,The role of histone deacetylases (HDACs) in human cancerMol Oncol20071192510.1016/j.molonc.2007.01.001Open DOISearch in Google Scholar
Li Z,Zhu WG, Targeting histone deacetylases for cancer therapy: from molecular mechanisms to clinical implications. Int J Biol Sci 2014; 10: 757-70. 10.7150/ijbs.9067LiZ,ZhuWG,Targeting histone deacetylases for cancer therapy: from molecular mechanisms to clinical implicationsInt J Biol Sci2014107577010.7150/ijbs.9067Open DOISearch in Google Scholar
Conte M, Dell’Aversana C, Benedetti R, Petraglia F, Carissimo A, Petrizzi VB, et al., HDAC2 deregulation in tumorigenesis is causally connected to repression of immune modulation and defense escape. Oncotarget 2015; 6: 886-901. 10.18632/oncotarget.2816ConteM,Dell’AversanaC,BenedettiR,PetragliaF,CarissimoA,PetrizziVB,et alHDAC2 deregulation in tumorigenesis is causally connected to repression of immune modulation and defense escapeOncotarget2015688690110.18632/oncotarget.2816Open DOISearch in Google Scholar
Alzoubi S, Brody L, Rahman S, Mahul-Mellier AL, Mercado N, Ito K, et al., Synergy between histone deacetylase inhibitors and DNA-damaging agents is mediated by histone deacetylase 2 in colorectal cancer. Oncotarget 2016; 7: 44505-44521. 10.18632/oncotarget.9887AlzoubiS,BrodyL,RahmanS,Mahul-MellierAL,MercadoN,ItoK,et alSynergy between histone deacetylase inhibitors and DNA-damaging agents is mediated by histone deacetylase 2 in colorectal cancerOncotarget20167445054452110.18632/oncotarget.9887Open DOISearch in Google Scholar
Qu X, Yu H, Jia B, Yu X, Cui Q, Liu Z, et al., Association of downregulated HDAC 2 with the impaired mitochondrial function and cytokine secretion in the monocytes/macrophages from gestational diabetes mellitus patients. Cell Biol Int 2016; 40: 642-51. 10.1002/cbin.10598QuX,YuH,JiaB,YuX,CuiQ,LiuZ,et alAssociation of downregulated HDAC 2 with the impaired mitochondrial function and cytokine secretion in the monocytes/macrophages from gestational diabetes mellitus patientsCell Biol Int2016406425110.1002/cbin.10598Open DOISearch in Google Scholar
Stojanovic N, Hassan Z, Wirth M, Wenzel P, Beyer M, Schafer C, et al., HDAC1 and HDAC2 integrate the expression of p53 mutants in pancreatic cancer. Oncogene 2016. 10.1038/onc.2016.344StojanovicN,HassanZ,WirthM,WenzelP,BeyerM,SchaferC,et alHDAC1 and HDAC2 integrate the expression of p53 mutants in pancreatic cancerOncogene201610.1038/onc.2016.344Open DOISearch in Google Scholar
Campos B, Bermejo JL, Han L, Felsberg J, Ahmadi R, Grabe N, et al., Expression of nuclear receptor corepressors and class I histone deacetylases in astrocytic gliomas. Cancer Sci 2011; 102: 387-92. 10.1111/j.1349-7006.2010.01792.xCamposB,BermejoJL,HanL,FelsbergJ,AhmadiR,GrabeN,et alExpression of nuclear receptor corepressors and class I histone deacetylases in astrocytic gliomasCancer Sci20111023879210.1111/j.1349-7006.2010.01792.xOpen DOISearch in Google Scholar
