1. bookVolume 71 (2022): Issue 1 (March 2022)
Journal Details
License
Format
Journal
eISSN
2544-4646
First Published
04 Mar 1952
Publication timeframe
4 times per year
Languages
English
access type Open Access

Screening of mcr-1 among Gram-Negative Bacteria from Different Clinical Samples from ICU Patients in Alexandria, Egypt: One-Year Study

Published Online: 30 Mar 2022
Page range: 83 - 90
Received: 10 Nov 2021
Accepted: 12 Feb 2022
Journal Details
License
Format
Journal
eISSN
2544-4646
First Published
04 Mar 1952
Publication timeframe
4 times per year
Languages
English
Abstract

Antimicrobial resistance represents a global dilemma. Our present study aimed to investigate the presence of mcr-1 among different Gram-negative bacteria including Enterobacteriaceae (except intrinsically resistant to colistin) and Pseudomonas aeruginosa. Gram-negative bacterial isolates were collected from different ICUs in several Alexandria hospitals from June 2019 to June 2020. The identification of these Gram-negative isolates was made using the VITEK-2® system (BioMérieux, France). SYBR Green-based PCR was used to screen for the presence of mcr-1 using a positive control that we amplified and sequenced earlier in our pilot study. All isolates were screened for the presence of mcr-1 regardless of their colistin susceptibility. Isolates that harbored mcr-1 were tested for colistin susceptibility and for the presence of some beta-lactamase genes. Klebsiella pneumoniae isolates harboring mcr-1 were capsule typed using the wzi sequence analysis. Four hundred eighty isolates were included in this study. Only six isolates harbored mcr-1.1. Of these, four were resistant to colistin, while two (K. pneumoniae and P. aeruginosa) were susceptible to colistin. Five of the six isolates were resistant to carbapenems. They harbored blaOXA-48, and three of them co-harbored blaNDM-1. K-58 was the most often found among our K. pneumoniae harboring mcr-1.1. To our knowledge, this is the first time to report colistin susceptible P. aeruginosa and K. pneumoniae harboring the mcr-1.1 gene in Egypt. Further studies are needed to investigate the presence of the mcr genes among colistin susceptible isolates to shed more light on its significance as a potential threat.

Keywords

Introduction

Resistance to antibacterial agents represents a global threat. Infections caused by multi-drug resistant (MDR) and extensively drug-resistant (XDR) bacteria are growing, representing a major therapeutic challenge. MDR bacteria are defined as those resistant to at least one agent in at least three distinct categories of antibacterial agents. In comparison, XDR bacteria are defined as those resistant to at least one agent in all categories except for two or fewer categories of antibacterial agents (Magiorakos et al. 2012) Currently, colistin remains one of the last resort treatments against these infections (El-Sayed Ahmed et al. 2020; Wang et al. 2020b). Colistin was first used in the 1950s to treat infections caused by Gram-negative bacteria. Then, in the 1970s, it was replaced by other newly discovered antimicrobial agents, which did not have the toxic effects caused by colistin (El-Sayed Ahmed et al. 2020). However, due to the increased resistance to all available antibacterial agents, colistin has resurfaced, in the 1990s, as the last line of defense against infections caused by MDR and XDR Gram-negative bacteria, although its safety profile has not changed and its dosing problem. There is a lack of a universal synchronization of colistin dose units, which leads to suboptimal dosing potentially contributing to the resistance problem (Lim et al. 2010; Ahern and Schnoor 2012; Kaye et al. 2016). In addition to MDR and XDR infections, colistin can be combined with other antibacterial agents to manage pan-resistant Gram-negative bacteria (Sayyahfar et al. 2021).

Interestingly, some Gram-negative bacteria are intrinsically resistant to colistin as Morganella spp., Serratia spp., Providencia spp., and Proteus spp. Colistin resistance was thought to be only chromosomally mediated; however, in 2015, the plasmid-mediated resistance to colistin was reported for the first time. Since then, different mcr-1 alleles have been described; furthermore, ten different mcr family genes (mcr-1-family gene to mcr-10-family gene) have been reported worldwide (Hussein et al. 2021). The emergence of horizontally acquired resistance hampers colistin as a last resort against MDR Gram-negative bacteria (Liu et al. 2016; Sun et al. 2018; El-Sayed Ahmed et al. 2020; Xu et al. 2021). Interestingly, colistin susceptible Escherichia coli isolates harboring either mcr-1 or other mcr family genes have been reported (Wang et al. 2017; Chen et al. 2019). The aim of our present study was to investigate the presence of mcr-1 among different Gram-negative bacteria including Enterobacteriaceae (except intrinsically resistant to colistin) and Pseudomonas aeruginosa.

Experimental
Materials and Methods
Sample collection

We conducted a one-year prospective study, during which Gram-negative bacterial isolates were consecutively collected over a one-year period, starting from June 2019 till June 2020. Non-duplicate isolates were collected from each patient. Isolates were collected from different ICUs in five major tertiary care hospitals in Alexandria, Egypt. Inclusion criteria included being ≥ 18 years old, minimal length of stay in ICU (five days), previous treatment with antibiotics including carbapenems, and failure of treatment denoted by the persistence of signs and symptoms of infection. We excluded Serratia marcescens, Providencia spp., and Proteus spp. because of their intrinsic resistance to colistin. These Gram-negative isolates were identified using the VITEK-2® system (BioMérieux, France).

Antimicrobial susceptibility testing

Susceptibility testing was performed using the disk diffusion method. Antimicrobial agents used were cefepime (FEP), ceftazidime (CAZ), imipenem (IPM), meropenem (MEM), amikacin (AK), gentamicin (GEN), tobramycin (TOB), ciprofloxacin (CIP), and trimethoprim/sulfamethoxazole (SXT), according to the CLSI guidelines (CLSI 2020). Colistin susceptibility testing was not performed at this point to ensure blind screening for the mcr-1 gene. Antibiotic disks and culture media were purchased from Oxoid (Cambridge, UK).

Screening for the mcr-1 gene among Gram-negative bacterial isolates

All collected Gram-negative isolates were screened for the presence of the mcr-1 gene using SYBR Green-based real-time PCR. The primers used were CLR5-F: CGGTCAGTCCGTTTGTTC and CLR5-R: CTTGGTCGGTCTGTAGGG (Liu et al. 2016). Isolate “PCMKP-01” was used as a positive control. This isolate was found to harbor mcr-1 (amplified and sequenced earlier in a pilot study that we conducted prior to the start of this study, and the details are shown in Supplementary materials).

Real-time PCR was performed on Stratagene Mx3000P (Agilent Technologies California, USA) using PowerUp SYBR Green Master Mix (Thermo Fischer, California, USA). The thermal profile was: activation at 95°C for 2 minutes, followed by 35 cycles of denaturation at 95°C for 20 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 1 minute, followed by melting curve analysis (95°C for 20 seconds, 50°C for 1 minute and 95°C for 20 seconds). For confirmation, any amplicon obtained using the primers mentioned above, was subsequently sequenced using an ABI 3730xl DNA sequencer (Applied Biosystems, California, USA).

Confirmation of identification and subtyping of the mcr-1 gene

To confirm the specific subtype of the mcr-1 gene, we amplified the whole mcr-1 gene using the conventional PCR, and the amplicon size was 1,672 bp. The primers used were: SQmcr-1F: CTCATGATGCAGCATACTTC and SQmcr-1R: CGAATGGAGTGTGCGGTG (Elnahriry et al. 2016). The amplification scheme was: 4 minutes activation at 95°C, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 90 seconds, and a final elongation step of 72°C for 7 minutes using the Veriti thermal cycler (Applied Biosystems, California, USA), and DreamTaq Green PCR Master Mix (Applied Biosystems, California, USA). Sequencing was performed using the same primers (forward and reverse) with the ABI 3730xl DNA sequencer (Applied Biosystems, California, USA).

Determination of colistin susceptibility

Isolates that were found to harbor mcr-1 were then tested for colistin susceptibility using the broth microdilution method according to CLSI (CLSI 2020).

Capsule typing of Klebsiella pneumoniae isolates

K. pneumoniae isolates, which were found to possess mcr-1 and our isolate “PCMKP-01” were subsequently subjected to capsule typing. The wzi gene was amplified and sequenced using primers wzi-F: GTGCC GCGAGCGCTTTCTATCTTGGTATTCC and wzi-R: GAGAGCCACTGGTTCCAGAA[C or T]TT[C or G] ACCGC (Brisse et al. 2013). Sequencing was performed using the ABI 3730xl DNA sequencer (Applied Biosystems, California, USA). Typing was performed using the K-PAM platform (https://www.iith.ac.in/K-PAM/pred_sertp.php) (Patro et al. 2020).

Genotypic detection of different beta-lactamase genes

All isolates that harbored the mcr-1 gene were further investigated for the presence of the blaCTX-M gene (encoding for ESBL), using conventional PCR on the Veriti thermal cycler (Applied Biosystems, California, USA), and DreamTaq Green PCR Master Mix (Applied Biosystems, California, USA). The primers used were F: CGCTTTGCGATGTGCAG, and R: ACCGCGATATCGTTGGT (Gröbner et al. 2009). Then, the isolates that harbored mcr-1 and were carbapenem-resistant were further investigated for the presence of serine carbapenemase genes (blaKPC and blaOXA-48), and metallo-beta-lactamases genes (blaVIM and blaNDM-1). The primers used were as follows: F: TGTCACTGTATCGCCGTC, and R: CTCAGTGCTCTACAGAAAACC for blaKPC (Wang et al. 2012); F: AAATCACAGGGCGTAGTTGTG, and R: GACCCACCAGCCAATCTTAG for blaOXA-48; F: AGTGGTGAGTATCCGACAG, and R: ATGAAAGTGCGTGGAGAC for blaVIM (Gröbner et al. 2009); and F: GGTTTGGCGATCTGGTTTTC, and R: CGGAATGGCTCATCACGATC) for blaNDM-1 (Nordmann et al. 2011).

Results

A total of 480 Gram-negative isolates were collected from June 2019 to June 2020. Most of the collected isolates were K. pneumoniae (62.71%), followed by E. coli (22.71 %), P. aeruginosa (11.46%), Enterobacter cloacae complex, and Enterobacter asburiae represented (2.92%) and (0.20 %) of the isolates, respectively. These isolates were collected from different types of clinical samples, including blood cultures (26%), urinary tract infections (17%), aspirates and swabs from surgical site infections (fluid and tissues) (31%), sterile body fluids, including (CSF, pleural fluid and perineal fluid) (2%), and respiratory tract infections (24%). Regarding the susceptibility testing results, resistance to the third and fourth generation cephalosporins was 82.29% and 78.33%, respectively, and they were distributed as follows: K. pneumoniae 92.36% and 87.38%, E. coli 78.9% and 77.06%, E. cloacae complex 64.29% and 71.43%, and P. aeruginosa 40% and 34.5%, respectively. Moreover, 49.79% of the isolates were resistant to MEM. They were distributed as follows: K. pneumoniae 68.44%, E. coli 6.42%, E. cloacae complex 21.43%, and P. aeruginosa 41.82%. Most of the Gram-negative organisms were resistant to CAZ and FEP, and almost half of the isolates were resistant to carbapenems and gentamicin. Among 480 isolates, 338 (70.4%) were MDR Gram-negative bacteria; of these seven isolates belong to E. cloacae complex, 25 were P. aeruginosa, 60 were E. coli, while 246 of them were K. pneumoniae isolates. The susceptibility testing results are shown in (Table I).

Resistance profiles of different isolates of Gram-negative bacteria.

Antimicrobial Klebsiella pneumoniae (n = 301) Escherichia coli (n = 109) Enterobacter cloaclae complex (n = 14) Enterobacter asburiae* (n = 1) Pseudomonas aeruginosa (n = 55)
Resistant Resistant Resistant Resistant Resistant
No. % No. % No. % No. % No. %
Ceftazidime 278 92.36 86 78.90 9 64.29 0 0 22 40.00
Cefepime 263 87.38 84 77.06 10 71.43 0 0 19 34.55
Imipenem 206 68.44 6 5.50 2 14.29 0 0 24 43.64
Meropenem 206 68.44 7 6.42 3 21.43 0 0 23 41.82
Amikacin 180 59.80 4 3.67 0 0 0 0 19 34.55
Gentamicin 177 58.80 36 33.03 6 42.86 0 0 24 43.64
Tobramycin 232 77.08 38 34.86 3 21.43 0 0 24 43.64
Ciprofloxacin 217 72.10 69 63.30 3 21.43 0 0 26 47.27
Trimethoprim/Sulfamethoxazole 231 76.74 59 54.13 6 42.86 0 0

– the isolate was susceptible to all these antibacterial agents

Among 480 Gram-negative bacterial isolates, only six (1.25%) harbored the mcr-1 gene, while 474 (98.75%) did not harbor that gene.

The mcr-1 gene was sequenced, then the BLASTN (https://blast.ncbi.nlm.nih.gov) tool for was used for confirmation. All isolates were found to harbor mcr-1.1. The obtained sequences were deposited in GenBank (accession numbers: MZ820395, MZ820396, MZ820398, MZ820399, MZ820400, MZ820401).

Then, to confirm the mcr-1 gene subtype, we amplified and sequenced the whole mcr-1 gene of all isolates; however, it could not be amplified in one K. pneumoniae isolate using this pair of primers. The obtained sequences were deposited in GenBank (accession number: MZ820389, MZ820390, MZ820391, MZ820393, MZ820394).

Remarkably, two isolates out of six isolates harboring mcr-1.1 were susceptible to colistin. Moreover, one of them could not be amplified using this pair of primers. However, it was successfully amplified and sequenced using the first primers set, and it was found to harbor mcr-1.1. Its sequence was submitted to Gen-Bank, as mentioned earlier.

Then, all K. pneumoniae isolates harboring mcr-1.1 and the isolate “PCMKP-01” were capsule typed using the wzi gene sequencing; three were K-58, one K-9, and one K-45. A phylogenetic tree was constructed, and it is shown in Fig. 1.

Fig. 1

Phylogenetic tree of four Klebsiella pneumoniae isolates and the positive control “PCMKP-01” harboring mcr-1.1 based on the wzi typing.

The characteristics of the six isolates that harbor mcr-1.1 is shown in Table II. Three of the six isolates harbored blaCTX-M. Five of the isolates were resistant to carbapenems. These five isolates harbored the blaOXA-48 gene, blaNDM-1 was present in three of them, while blaVIM and blaKPC were absent in these isolates. The distribution of the different beta-lactamase genes among the six isolates is shown in Table III.

Characteristics of six bacterial isolates harboring mcr-1.

Organism Isolate name k-type Sample Source mcr-1 amplified by first set of primers mcr-1amplified by second set of primers Patient gender FEP CAZ IPM MEM AK GN TOB CIP SXT MIC value in µg/ml*
P. aeruginosa MPPS-05 BAL mcr-1.1 mcr-1.1 F R R R I R R R R ≤ 0.5
K. pneumoniae MPKP-07 K9 Mini BAL mcr-1.1 F R R R R R R R R S ≤ 0.5
K. pneumoniae MPKP-03 k58 BAL mcr-1.1 mcr-1.1 M R R R R R I R R R 4
K. pneumoniae MPKP-04 k58 Spinal fluid mcr-1.1 mcr-1.1 F R R R R R R R I R 4
K. pneumoniae MPKP-06 k58 Sputum mcr-1.1 mcr-1.1 M R R R R R S R R R 4
E. coli MPEC-02 Blood culture mcr-1.1 mcr-1.1 M R R S S S R R I R ≥ 4

– colistin MIC was interpreted according to EUCAST guidelines (EUCAST 2020)

Beta-lactamase genes distribution among the mcr-1 positive isolates.

Organism Isolate name mcr-1 amplified by first set of primers mcr-1 amplified by second set of primers ESBL Gene Serine carbapenemasesgenes Metallo-beta-lactamase genes
blaCTX-M blaKPC blaOXA-48 blaVIM blaNDM-1
P. aeruginosa MPPS-05 mcr-1.1 mcr-1.1 + +
K. pneumoniae MPKP-07 mcr-1.1 + +
K. pneumoniae MPKP-03 mcr-1.1 mcr-1.1 + + +
K. pneumoniae MPKP-04 mcr-1.1 mcr-1.1 + +
K. pneumoniae MPKP-06 mcr-1.1 mcr-1.1 +
E. coli MPEC-02 mcr-1.1 mcr-1.1 + NT NT NT NT

NT – organism was not tested as it was sensitive to carbapenems

Discussion

Colistin remains our last resort against MDR and XDR Gram-negative bacteria. Moreover, it has been combined with other antibacterial agents to manage infections caused by pan-resistant Gram-negative bacteria (Sayyahfar et al. 2021). Different mechanisms of resistance contribute to the reduced susceptibility to colistin. However, the most worrying mechanism is plasmid-borne MCR-mediated resistance due to its ability to horizontally transfer between different species and the speed with which it is evolving. Several mcr family genes have been detected since they were first described in 2015 (Feng 2018; Xu et al. 2021).

Some studies reported the presence of mcr-1 among E. coli isolates susceptible to colistin, which would further complicate the situation in health care settings. Patients infected with organisms harboring the mcr-1 gene represent a potential threat for mcr-1 transmission because these organisms could escape being detected by conventional phenotypic methods. Furthermore, other resistance genes (beta lactamases and non-beta lactamases genes) could also be transmitted along with the mcr-1 gene. (Yuan et al. 2021) This study aimed to investigate the presence of mcr-1 among different Gram-negative bacteria, including Enterobacteriaceae (except intrinsically resistant to colistin) and P. aeruginosa.

Using SYBR Green-based real-time PCR, we screened for mcr-1 among the 480 Gram-negative bacterial isolates. Only 6 (1.25%) isolates harbored this gene, which was confirmed by sequencing of the amplicon obtained. Four of these six isolates were K. pneumoniae, one isolate was E. coli, and the remaining one was P. aeruginosa.

The first report of mcr-1 from a clinical isolate in Egypt was provided in 2016 by Elnahriry et al. (2016). Then, different studies reported the presence of mcr-1 among E. coli clinical isolates in Egypt, including Anan et al. (2021), who found only four (7.5%) E. coli harboring mcr-1 among colistin-resistant isolates, and El-Mokhtar et al. (2021) who reported that all their studied E. coli isolates resistant to colistin carried mcr-1. Moreover, another study reported the presence of mcr-1 in one E. coli and one K. pneumoniae isolate among their 450 enterobacterial isolates (Zafer et al. 2019).

Furthermore, Elmonir et al. (2021) reported that all colistin-resistant K. pneumoniae isolates harbored the mcr-1 gene. Abd El-Baky et al. (2020) reported the presence of mcr-1 among their P. aeruginosa isolates. Additionally, Yanat et al. (2016) reported the presence of mcr-1 in E. coli clinical isolate in Algeria, Alghoribi et al. (2019) also found mcr-1 gene in uropathogenic E. coli in Saudia Arabia, and mcr-1 was also reported from E. coli clinical isolate in Lebanon (Al-Bayssari et al. 2021). However, some studies could not detect mcr-1 among colistin-resistant bacterial isolates, Ramadan et al. (2020) did not find any of the eight mcr family genes (mcr-1 to mcr-8) among 65 Gram-negative bacterial isolates (Soliman et al. 2020b). In a study in Tunisia, they could not find any of the mcr genes, from mcr-1 to mcr-5 (Jaidane et al. 2018). Sadek et al. (2020b) reported only one E. coli isolate harboring mcr-1 among 128 colistin resistant E. coli strains isolated from meat and meat product samples in Egypt.

In this study, six isolates that harbored mcr-1.1 were tested for colistin susceptibility; four were found to be resistant to colistin, while two isolates (one K. pneumoniae and one P. aeruginosa) were found to be susceptible to colistin (≤ 0.5 µg/ml). To confirm the mcr-1 subtype, we attempted to amplify and sequence the whole mcr-1 gene among the six isolates, using another set of primers. Five isolates harbored mcr-1.1 and the remaining one (K. pneumoniae) could not be amplified using this set of primers. Interestingly, mcr-1.1 was reported in Egypt before; in one uropathogenic E. coli (UPEC) (Zakaria et al. 2021) and five E. coli isolated from chicken (Soliman et al. 2021). Moreover, mcr-1.1 was reported in E. coli isolate obtained from wound drainage (Eltai et al. 2020) from Qatar. Girardello et al. (2021) reported the presence of mcr-1.1 in E. coli clinical isolate in Sao Paulo, and mcr-1.1 was found in two K. pneumoniae clinical isolates by Rocha et al. (2020).

In this study, the K. pneumoniae isolate, whose mcr-1 gene could not be amplified using the second set of primers (used to amplify the whole mcr-1 gene), was susceptible to colistin. Another colistin susceptible isolate was P. aeruginosa, which was found to harbor the mcr-1.1 gene.

Previously, some studies have reported Gram-negative isolates susceptible to colistin and harboring the mcr-1 gene. Wang et al. (2017) described two colistin-susceptible E. coli isolates possessing the mcr-1 gene. Terveer et al. (2017) also reported a colistin-susceptible E. coli harboring mcr-1, which was not functioning. Using WGS, they found that the gene was rendered not functional by a transposon (IS10R) insertion (Terveer et al. 2017). Zhou et al. (2018) also described a fluoroquinolone-resistant but colistin-susceptible E. coli carrying mcr-1, which was also non-functional by inserting a 1.7-Kb IS1294b element. Chen et al. (2019) also reported a colistin-susceptible E. coli harboring mcr-1, which was non-functional because of the insertion of another gene. Jiang et al. (2020) described a colistin susceptible E. coli harboring the mcr-1 gene, which had mutations in the mcr-1 promotor sequence.

However, to the best of our knowledge, this is the first study reporting the presence of mcr-1 in colistin susceptible K. pneumoniae and P. aeruginosa in Egypt. The whole mcr-1 gene in the susceptible K. pneumoniae could not be amplified using the second set of primers and it was found to be susceptible to colistin; it may be due to an insertion sequence that rendered the gene non-functional. However, in our case, WGS was not feasible due to its high cost and the fact that this study was not funded. Besides the mcr-1 gene, other mcr family genes have also been described in colistin-susceptible bacteria. Ragupathi et al. (2020) reported the presence of the mcr-3.30 gene in colistin-susceptible Aeromonas veronii. The mcr-3.30 gene was disrupted due to the insertion of ISAs18 (Ragupathi et al. 2020). The mcr-9 is another mcr family gene that was reported in other studies, including a study conducted by Soliman et al. (2020a), who reported the presence of this gene in colistin susceptible Enterobacter hormaechei clinical isolate from Egypt. Other colistin susceptible E. hormaechei harboring mcr-9 were also reported in Egypt in pets with respiratory diseases (Khalifa et al. 2020a) and from food of animal origin (Sadek et al. 2020a). Carroll et al. (2019) reported the presence of mcr-9 in the MDR Salmonella enterica subsp. enterica serotype Typhimurium isolate, which was susceptible to colistin. Also, another study conducted by Kananizadeh et al. (2020) reported the presence of mcr-9 in E. cloacae complex in Japan. Khalifa et al. (2020b) found mcr-9 in colistin-susceptible foodborne K. pneumoniae. The mcr-9 subtype was also reported by Marchetti et al. (2021) who reported mcr-9.2 in a colistin susceptible E. cloacae. The mcr-10 was described by Wang et al. (2020a) in Enterobacter roggenkampii that was susceptible to colistin.

In this study, four K. pneumoniae isolates that harbored the mcr-1.1 gene and “PCMKP-01” were capsule typed using the wzi gene sequence analysis. The most common K-type found among these isolates was K-58. It was found in three isolates. K-58 has not been associated with virulence (Turton et al. 2010). These three isolates were MDR strains of K. pneumoniae resistant to colistin that harbor the mcr-1.1 gene. The two remaining K-types were K-9 and K-45. K-45 type K. pneumoniae was considered the positive control isolate “PCMKP-01”. It was the MDR colistin-resistant isolate, while K-45 type isolate was colistin susceptible K. pneumoniae that harbored mcr-1.1.

Three of the isolates co-harbored mcr-1.1 and blaCTX-M. Sadek et al. (2021) reported that nine of the isolates co-harbored the mcr-1 gene and ESBL genes. In the present study, five isolates harbored mcr-1.1 and were resistant to carbapenems. These five isolates had blaOXA-48, and three of them had blaNDM-1 (one P. aeuruginsa isolate and two K. pneumoniae isolates). blaVIM and blaKPC were not found among these five isolates. Singh et al. (2021) reported that all the isolates harboring mcr-1 in their study co-harbored blaOXA-48. Han et al. (2020) reported the identification of the XDR E. coli clinical isolate co-harboring mcr-1 and blaNDM-1. Al-Bayssari et al. (2021) reported the co-existence of blaNDM-4 and mcr-1 among E. coli clinical isolates.

Conclusion

To our knowledge, it is the first time to report colistin susceptible P. aeruginosa and K. pneumoniae harboring the mcr-1.1 gene in Egypt. The mcr-1.1 gene was fully sequenced in P. aeruginosa, while in K. pneumoniae it could not be fully sequenced, which indicated some abnormality in this gene. The most frequently found K-type was K-58. Five of the isolates were resistant to carbapenems and co-harbored blaOXA-48 and mcr-1, and three of them co-harbored mcr-1.1, blaOXA-48, and blaNDM-1. Co-existence of these genes together is a clear therapeutic challenge. Further studies are still needed to investigate the presence of the plasmid-borne mcr genes among colistin susceptible isolates to shed more light on its significance as a potential threat.

Fig. 1

Phylogenetic tree of four Klebsiella pneumoniae isolates and the positive control “PCMKP-01” harboring mcr-1.1 based on the wzi typing.
Phylogenetic tree of four Klebsiella pneumoniae isolates and the positive control “PCMKP-01” harboring mcr-1.1 based on the wzi typing.

Resistance profiles of different isolates of Gram-negative bacteria.

Antimicrobial Klebsiella pneumoniae (n = 301) Escherichia coli (n = 109) Enterobacter cloaclae complex (n = 14) Enterobacter asburiae* (n = 1) Pseudomonas aeruginosa (n = 55)
Resistant Resistant Resistant Resistant Resistant
No. % No. % No. % No. % No. %
Ceftazidime 278 92.36 86 78.90 9 64.29 0 0 22 40.00
Cefepime 263 87.38 84 77.06 10 71.43 0 0 19 34.55
Imipenem 206 68.44 6 5.50 2 14.29 0 0 24 43.64
Meropenem 206 68.44 7 6.42 3 21.43 0 0 23 41.82
Amikacin 180 59.80 4 3.67 0 0 0 0 19 34.55
Gentamicin 177 58.80 36 33.03 6 42.86 0 0 24 43.64
Tobramycin 232 77.08 38 34.86 3 21.43 0 0 24 43.64
Ciprofloxacin 217 72.10 69 63.30 3 21.43 0 0 26 47.27
Trimethoprim/Sulfamethoxazole 231 76.74 59 54.13 6 42.86 0 0

Characteristics of six bacterial isolates harboring mcr-1.

Organism Isolate name k-type Sample Source mcr-1 amplified by first set of primers mcr-1amplified by second set of primers Patient gender FEP CAZ IPM MEM AK GN TOB CIP SXT MIC value in µg/ml*
P. aeruginosa MPPS-05 BAL mcr-1.1 mcr-1.1 F R R R I R R R R ≤ 0.5
K. pneumoniae MPKP-07 K9 Mini BAL mcr-1.1 F R R R R R R R R S ≤ 0.5
K. pneumoniae MPKP-03 k58 BAL mcr-1.1 mcr-1.1 M R R R R R I R R R 4
K. pneumoniae MPKP-04 k58 Spinal fluid mcr-1.1 mcr-1.1 F R R R R R R R I R 4
K. pneumoniae MPKP-06 k58 Sputum mcr-1.1 mcr-1.1 M R R R R R S R R R 4
E. coli MPEC-02 Blood culture mcr-1.1 mcr-1.1 M R R S S S R R I R ≥ 4

Beta-lactamase genes distribution among the mcr-1 positive isolates.

Organism Isolate name mcr-1 amplified by first set of primers mcr-1 amplified by second set of primers ESBL Gene Serine carbapenemasesgenes Metallo-beta-lactamase genes
blaCTX-M blaKPC blaOXA-48 blaVIM blaNDM-1
P. aeruginosa MPPS-05 mcr-1.1 mcr-1.1 + +
K. pneumoniae MPKP-07 mcr-1.1 + +
K. pneumoniae MPKP-03 mcr-1.1 mcr-1.1 + + +
K. pneumoniae MPKP-04 mcr-1.1 mcr-1.1 + +
K. pneumoniae MPKP-06 mcr-1.1 mcr-1.1 +
E. coli MPEC-02 mcr-1.1 mcr-1.1 + NT NT NT NT

Abd El-Baky RM, Masoud SM, Mohamed DS, Waly NGFM, Shafik EA, Mohareb DA, Elkady A, Elbadr MM, Hetta HF. Prevalence and some possible mechanisms of colistin resistance among multidrug-resistant and extensively drug-resistant Pseudomonas aeruginosa. Infect Drug Resist. 2020 Feb;13:323–332. https://doi.org/10.2147/IDR.S238811 Abd El-BakyRM MasoudSM MohamedDS WalyNGFM ShafikEA MoharebDA ElkadyA ElbadrMM HettaHF Prevalence and some possible mechanisms of colistin resistance among multidrug-resistant and extensively drug-resistant Pseudomonas aeruginosa Infect Drug Resist 2020 Feb 13 323 332 https://doi.org/10.2147/IDR.S238811 10.2147/IDR.S238811 Search in Google Scholar

Ahern JW, Schnoor JB. Colistin: potential for dosage error. Clin Infect Dis. 2012 Nov 01;55(9):1275, author reply 1275–1276. https://doi.org/10.1093/cid/cis632 AhernJW SchnoorJB Colistin: potential for dosage error Clin Infect Dis 2012 Nov 01 55 9 1275 author reply 1275–1276. https://doi.org/10.1093/cid/cis632 10.1093/cid/cis632 Search in Google Scholar

Al-Bayssari C, Nawfal Dagher T, El Hamoui S, Fenianos F, Makdissy N, Rolain JM, Nasreddine N. Carbapenem and colistin-resistant bacteria in North Lebanon: coexistence of mcr-1 and NDM-4 genes in Escherichia coli. J Infect Dev Ctries. 2021 Jul 31; 15(07):934–342. https://doi.org/10.3855/jidc.14176 Al-BayssariC Nawfal DagherT El HamouiS FenianosF MakdissyN RolainJM NasreddineN Carbapenem and colistin-resistant bacteria in North Lebanon: coexistence of mcr-1 and NDM-4 genes in Escherichia coli J Infect Dev Ctries 2021 Jul 31 15 07 934 342 https://doi.org/10.3855/jidc.14176 10.3855/jidc.14176 Search in Google Scholar

Alghoribi MF, Doumith M, Upton M, Al Johani SM, Alzayer M, Woodford N, Ellington MJ, Balkhy HH. Complete genome sequence of a colistin-resistant uropathogenic Escherichia coli sequence type 131 fimH22 strain harboring mcr-1 on an IncHI2 plasmid, isolated in Riyadh, Saudi Arabia. Microbiol Resour Announc. 2019 May 2;8(18): e00104-19. https://doi.org/10.1128/MRA.00104-19 AlghoribiMF DoumithM UptonM Al JohaniSM AlzayerM WoodfordN EllingtonMJ BalkhyHH Complete genome sequence of a colistin-resistant uropathogenic Escherichia coli sequence type 131 fimH22 strain harboring mcr-1 on an IncHI2 plasmid, isolated in Riyadh, Saudi Arabia Microbiol Resour Announc 2019 May 2 8 18 e00104-19. https://doi.org/10.1128/MRA.00104-19 10.1128/MRA.00104-19 Search in Google Scholar

Anan MMG, El-Seidi EA, Mostafa MS, Rashed LA, El-Wakil DM. Detection of plasmid-mediated mobile colistin resistance gene (mcr-1) in Enterobacterales isolates from a University Hospital. Infect Drug Resist. 2021 Aug;14:3063–3070. https://doi.org/10.2147/IDR.S318787 AnanMMG El-SeidiEA MostafaMS RashedLA El-WakilDM Detection of plasmid-mediated mobile colistin resistance gene (mcr-1) in Enterobacterales isolates from a University Hospital Infect Drug Resist 2021 Aug 14 3063 3070 https://doi.org/10.2147/IDR.S318787 10.2147/IDR.S318787 Search in Google Scholar

Brisse S, Passet V, Haugaard AB, Babosan A, Kassis-Chikhani N, Struve C, Decré D. wzi Gene sequencing, a rapid method for determination of capsular type for Klebsiella strains. J Clin Microbiol. 2013 Dec 01;51(12):4073–4078. https://doi.org/10.1128/JCM.01924-13 BrisseS PassetV HaugaardAB BabosanA Kassis-ChikhaniN StruveC DecréD wzi Gene sequencing, a rapid method for determination of capsular type for Klebsiella strains J Clin Microbiol 2013 Dec 01 51 12 4073 4078 https://doi.org/10.1128/JCM.01924-13 10.1128/JCM.01924-13 Search in Google Scholar

Carroll LM, Gaballa A, Guldimann C, Sullivan G, Henderson LO, Wiedmann M. Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible Salmonella enterica serotype Typhimurium isolate. MBio. 2019 Jun 25; 10(3): e00853-19. https://doi.org/10.1128/mBio.00853-19 CarrollLM GaballaA GuldimannC SullivanG HendersonLO WiedmannM Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible Salmonella enterica serotype Typhimurium isolate MBio 2019 Jun 25 10 3 e00853-19. https://doi.org/10.1128/mBio.00853-19 10.1128/mBio.00853-19 Search in Google Scholar

Chen CW, Tang HJ, Chen CC, Lu YC, Chen HJ, Su BA, Weng TC, Chuang YC, Lai CC. The microbiological characteristics of carbapenem-resistant Enterobacteriaceae carrying the mcr-1 gene. J Clin Med. 2019 Feb 19;8(2):261. https://doi.org/10.3390/jcm8020261 ChenCW TangHJ ChenCC LuYC ChenHJ SuBA WengTC ChuangYC LaiCC The microbiological characteristics of carbapenem-resistant Enterobacteriaceae carrying the mcr-1 gene J Clin Med 2019 Feb 19 8 2 261 https://doi.org/10.3390/jcm8020261 10.3390/jcm8020261 Search in Google Scholar

CLSI. Performance standards for antimicrobial susceptibility testing. 30th ed. CLSI supplement M100. Wayne (USA): Clinical and Laboratory Standards Institute; 2020. p. 16–38. CLSI Performance standards for antimicrobial susceptibility testing 30th ed. CLSI supplement M100. Wayne (USA) Clinical and Laboratory Standards Institute 2020 16 38 Search in Google Scholar

El-Mokhtar MA, Daef E, Mohamed Hussein AAR, Hashem MK, Hassan HM. Emergence of nosocomial pneumonia caused by colistin-resistant Escherichia coli in patients admitted to chest intensive care unit. Antibiotics (Basel). 2021 Feb 24;10(3):226. https://doi.org/10.3390/antibiotics10030226 El-MokhtarMA DaefE Mohamed HusseinAAR HashemMK HassanHM Emergence of nosocomial pneumonia caused by colistin-resistant Escherichia coli in patients admitted to chest intensive care unit Antibiotics (Basel) 2021 Feb 24 10 3 226 https://doi.org/10.3390/antibiotics10030226 10.3390/antibiotics10030226 Search in Google Scholar

Elmonir W, Abd El-Aziz NK, Tartor YH, Moustafa SM, Abo Remela EM, Eissa R, Saad HA, Tawab AA. Emergence of colistin and carbapenem resistance in extended-spectrum β-lactamase producing Klebsiella pneumoniae isolated from chickens and humans in Egypt. Biology (Basel). 2021 Apr 26;10(5):373. https://doi.org/10.3390/biology10050373 ElmonirW Abd El-AzizNK TartorYH MoustafaSM Abo RemelaEM EissaR SaadHA TawabAA Emergence of colistin and carbapenem resistance in extended-spectrum β-lactamase producing Klebsiella pneumoniae isolated from chickens and humans in Egypt Biology (Basel) 2021 Apr 26 10 5 373 https://doi.org/10.3390/biology10050373 10.3390/biology10050373 Search in Google Scholar

Elnahriry SS, Khalifa HO, Soliman AM, Ahmed AM, Hussein AM, Shimamoto T, Shimamoto T. Emergence of plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate from Egypt. Antimicrob Agents Chemother. 2016 May;60(5):3249–3250. https://doi.org/10.1128/AAC.00269-16 ElnahrirySS KhalifaHO SolimanAM AhmedAM HusseinAM ShimamotoT ShimamotoT Emergence of plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate from Egypt Antimicrob Agents Chemother 2016 May 60 5 3249 3250 https://doi.org/10.1128/AAC.00269-16 10.1128/AAC.00269-16 Search in Google Scholar

El-Sayed Ahmed MAEG, Zhong LL, Shen C, Yang Y, Doi Y, Tian GB. Colistin and its role in the era of antibiotic resistance: an extended review (2000–2019). Emerg Microbes Infect. 2020 Jan 01;9(1):868–885. https://doi.org/10.1080/22221751.2020.1754133 El-Sayed AhmedMAEG ZhongLL ShenC YangY DoiY TianGB Colistin and its role in the era of antibiotic resistance: an extended review (2000–2019) Emerg Microbes Infect 2020 Jan 01 9 1 868 885 https://doi.org/10.1080/22221751.2020.1754133 10.1080/22221751.2020.1754133 Search in Google Scholar

Eltai NO, Kelly B, Al-Mana HA, Ibrahim EB, Yassine HM, Al Thani A, Al Maslmani M, Lammens C, Xavier BB, Malhotra-Kumar S. Identification of mcr-8 in clinical isolates from Qatar and evaluation of their antimicrobial profiles. Front Microbiol. 2020 Aug 24;11:1954. https://doi.org/10.3389/fmicb.2020.01954 EltaiNO KellyB Al-ManaHA IbrahimEB YassineHM Al ThaniA Al MaslmaniM LammensC XavierBB Malhotra-KumarS Identification of mcr-8 in clinical isolates from Qatar and evaluation of their antimicrobial profiles Front Microbiol 2020 Aug 24 11 1954 https://doi.org/10.3389/fmicb.2020.01954 10.3389/fmicb.2020.01954 Search in Google Scholar

EUCAST. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 10.0. Basel (Switzerland): The European Committee on Antimicrobial Susceptibility Testing; 2020. Available from https://www.eucast.org/ast_of_bacteria/previous_versions_of_documents/ EUCAST The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 10.0 Basel (Switzerland) The European Committee on Antimicrobial Susceptibility Testing 2020 Available from https://www.eucast.org/ast_of_bacteria/previous_versions_of_documents/ Search in Google Scholar

Feng Y. Transferability of MCR-1/2 polymyxin resistance: complex dissemination and genetic mechanism. ACS Infect Dis. 2018 Mar 09; 4(3):291–300. https://doi.org/10.1021/acsinfecdis.7b00201 FengY Transferability of MCR-1/2 polymyxin resistance: complex dissemination and genetic mechanism ACS Infect Dis 2018 Mar 09 4 3 291 300 https://doi.org/10.1021/acsinfecdis.7b00201 10.1021/acsinfecdis.7b00201 Search in Google Scholar

Girardello R, Piroupo CM, Martins J Jr, Maffucci MH, Cury AP, Franco MRG, Malta FM, Rocha NC, Pinho JRR, Rossi F, et al. Genomic characterization of mcr-1.1-producing Escherichia coli recovered from human infections in São Paulo, Brazil. Front Microbiol. 2021 Jun 9;12:663414. https://doi.org/10.3389/fmicb.2021.663414 GirardelloR PiroupoCM MartinsJJr MaffucciMH CuryAP FrancoMRG MaltaFM RochaNC PinhoJRR RossiF Genomic characterization of mcr-1.1-producing Escherichia coli recovered from human infections in São Paulo, Brazil Front Microbiol 2021 Jun 9 12 663414. https://doi.org/10.3389/fmicb.2021.663414 10.3389/fmicb.2021.663414 Search in Google Scholar

Gröbner S, Linke D, Schütz W, Fladerer C, Madlung J, Autenrieth IB, Witte W, Pfeifer Y. Emergence of carbapenem-non-susceptible extended-spectrum β-lactamase-producing Klebsiella pneumoniae isolates at the university hospital of Tübingen, Germany. J Med Microbiol. 2009 Jul 01;58(7):912–922. https://doi.org/10.1099/jmm.0.005850-0 GröbnerS LinkeD SchützW FladererC MadlungJ AutenriethIB WitteW PfeiferY Emergence of carbapenem-non-susceptible extended-spectrum β-lactamase-producing Klebsiella pneumoniae isolates at the university hospital of Tübingen, Germany J Med Microbiol 2009 Jul 01 58 7 912 922 https://doi.org/10.1099/jmm.0.005850-0 10.1099/jmm.0.005850-0 Search in Google Scholar

Han S, Kim JS, Hong CK, Park SH, Kim HS, Yu JK, Park J, Kim J, Lee SM, Oh YH. Identification of an extensively drug-resistant Escherichia coli clinical strain harboring mcr-1 and blaNDM-1 in Korea. J Antibiot (Tokyo). 2020 Dec;73(12):852–858. https://doi.org/10.1038/s41429-020-0350-1 HanS KimJS HongCK ParkSH KimHS YuJK ParkJ KimJ LeeSM OhYH Identification of an extensively drug-resistant Escherichia coli clinical strain harboring mcr-1 and blaNDM-1 in Korea J Antibiot (Tokyo) 2020 Dec 73 12 852 858 https://doi.org/10.1038/s41429-020-0350-1 10.1038/s41429-020-0350-1 Search in Google Scholar

Hussein NH, AL-Kadmy IMS, Taha BM, Hussein JD. Mobilized colistin resistance (mcr) genes from 1 to 10: a comprehensive review. Mol Biol Rep. 2021 Mar;48(3):2897–2907. https://doi.org/10.1007/s11033-021-06307-y HusseinNH AL-KadmyIMS TahaBM HusseinJD Mobilized colistin resistance (mcr) genes from 1 to 10: a comprehensive review Mol Biol Rep 2021 Mar 48 3 2897 2907 https://doi.org/10.1007/s11033-021-06307-y 10.1007/s11033-021-06307-y Search in Google Scholar

Jaidane N, Bonnin RA, Mansour W, Girlich D, Creton E, Cotellon G, Chaouch C, Boujaafar N, Bouallegue O, Naas T. Genomic insights into colistin-resistant Klebsiella pneumoniae from a Tunisian Teaching Hospital. Antimicrob Agents Chemother. 2018 Feb;62(2):e01601-17. https://doi.org/10.1128/AAC.01601-17 JaidaneN BonninRA MansourW GirlichD CretonE CotellonG ChaouchC BoujaafarN BouallegueO NaasT Genomic insights into colistin-resistant Klebsiella pneumoniae from a Tunisian Teaching Hospital Antimicrob Agents Chemother 2018 Feb 62 2 e01601-17. https://doi.org/10.1128/AAC.01601-17 10.1128/AAC.01601-17 Search in Google Scholar

Jiang Y, Zhang Y, Lu J, Wang Q, Cui Y, Wang Y, Quan J, Zhao D, Du X, Liu H, et al. Clinical relevance and plasmid dynamics of mcr-1-positive Escherichia coli in China: a multicentre case-control and molecular epidemiological study. Lancet Microbe. 2020 May; 1(1):e24–e33. https://doi.org/10.1016/S2666-5247(20)30001-X JiangY ZhangY LuJ WangQ CuiY WangY QuanJ ZhaoD DuX LiuH Clinical relevance and plasmid dynamics of mcr-1-positive Escherichia coli in China: a multicentre case-control and molecular epidemiological study Lancet Microbe 2020 May 1 1 e24 e33 https://doi.org/10.1016/S2666-5247(20)30001-X 10.1016/S2666-5247(20)30001-X Search in Google Scholar

Kananizadeh P, Oshiro S, Watanabe S, Iwata S, Kuwahara-Arai K, Shimojima M, Ogawa M, Tada T, Kirikae T. Emergence of carbapenem-resistant and colistin-susceptible Enterobacter cloacae complex co-harboring blaIMP-1 and mcr-9 in Japan. BMC Infect Dis. 2020 Dec;20(1):282. https://doi.org/10.1186/s12879-020-05021-7 KananizadehP OshiroS WatanabeS IwataS Kuwahara-AraiK ShimojimaM OgawaM TadaT KirikaeT Emergence of carbapenem-resistant and colistin-susceptible Enterobacter cloacae complex co-harboring blaIMP-1 and mcr-9 in Japan BMC Infect Dis 2020 Dec 20 1 282 https://doi.org/10.1186/s12879-020-05021-7 10.1186/s12879-020-05021-7 Search in Google Scholar

Kaye KS, Pogue JM, Tran TB, Nation RL, Li J. Agents of last resort: Polymyxin resistance. Infect Dis Clin North Am. 2016 Jun; 30(2):391–414. https://doi.org/10.1016/j.idc.2016.02.005 KayeKS PogueJM TranTB NationRL LiJ Agents of last resort: Polymyxin resistance Infect Dis Clin North Am 2016 Jun 30 2 391 414 https://doi.org/10.1016/j.idc.2016.02.005 10.1016/j.idc.2016.02.005 Search in Google Scholar

Khalifa HO, Oreiby AF, Abd El-Hafeez AA, Okanda T, Haque A, Anwar KS, Tanaka M, Miyako K, Tsuji S, Kato Y, et al. First Report of multidrug-resistant carbapenemase-producing bacteria coharboring mcr-9 associated with respiratory disease complex in pets: potential of animal-human transmission. Antimicrob Agents Chemother. 2020a Dec 16;65(1):e01890-20. https://doi.org/10.1128/AAC.01890-20 KhalifaHO OreibyAF Abd El-HafeezAA OkandaT HaqueA AnwarKS TanakaM MiyakoK TsujiS KatoY First Report of multidrug-resistant carbapenemase-producing bacteria coharboring mcr-9 associated with respiratory disease complex in pets: potential of animal-human transmission Antimicrob Agents Chemother 2020a Dec 16 65 1 e01890-20. https://doi.org/10.1128/AAC.01890-20 10.1128/AAC.01890-20 Search in Google Scholar

Khalifa HO, Soliman AM, Saito T, Kayama S, Yu L, Hisatsune J, Sugai M, Nariya H, Ahmed AM, Shimamoto T, et al. First report of foodborne Klebsiella pneumoniae coharboring blaVIM-1, blaNDM-1, and mcr-9. Antimicrob Agents Chemother. 2020b Aug 20;64(9):e00882-20. https://doi.org/10.1128/AAC.00882-20 KhalifaHO SolimanAM SaitoT KayamaS YuL HisatsuneJ SugaiM NariyaH AhmedAM ShimamotoT First report of foodborne Klebsiella pneumoniae coharboring blaVIM-1, blaNDM-1, and mcr-9 Antimicrob Agents Chemother 2020b Aug 20 64 9 e00882-20. https://doi.org/10.1128/AAC.00882-20 10.1128/AAC.00882-20 Search in Google Scholar

Lim LM, Ly N, Anderson D, Yang JC, Macander L, Jarkowski A 3rd, Forrest A, Bulitta JB, Tsuji BT. Resurgence of colistin: a review of resistance, toxicity, pharmacodynamics, and dosing. Pharmacotherapy. 2010 Dec;30(12):1279–1291. https://doi.org/10.1592/phco.30.12.1279 LimLM LyN AndersonD YangJC MacanderL JarkowskiA3rd ForrestA BulittaJB TsujiBT Resurgence of colistin: a review of resistance, toxicity, pharmacodynamics, and dosing Pharmacotherapy 2010 Dec 30 12 1279 1291 https://doi.org/10.1592/phco.30.12.1279 10.1592/phco.30.12.1279 Search in Google Scholar

Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016 Feb;16(2):161–168. https://doi.org/10.1016/S1473-3099(15)00424-7 LiuYY WangY WalshTR YiLX ZhangR SpencerJ DoiY TianG DongB HuangX Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study Lancet Infect Dis 2016 Feb 16 2 161 168 https://doi.org/10.1016/S1473-3099(15)00424-7 10.1016/S1473-3099(15)00424-7 Search in Google Scholar

Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012 Mar;18(3):268–281. https://doi.org/10.1111/j.1469-0691.2011.03570.x MagiorakosAP SrinivasanA CareyRB CarmeliY FalagasME GiskeCG HarbarthS HindlerJF KahlmeterG Olsson-LiljequistB Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance Clin Microbiol Infect 2012 Mar 18 3 268 281 https://doi.org/10.1111/j.1469-0691.2011.03570.x 10.1111/j.1469-0691.2011.03570.x Search in Google Scholar

Marchetti VM, Bitar I, Sarti M, Fogato E, Scaltriti E, Bracchi C, Hrabak J, Pongolini S, Migliavacca R. Genomic characterization of VIM and MCR co-producers: the first two clinical cases, in Italy. Diagnostics (Basel). 2021 Jan 06;11(1):79. https://doi.org/10.3390/diagnostics11010079 MarchettiVM BitarI SartiM FogatoE ScaltritiE BracchiC HrabakJ PongoliniS MigliavaccaR Genomic characterization of VIM and MCR co-producers: the first two clinical cases, in Italy Diagnostics (Basel) 2021 Jan 06 11 1 79 https://doi.org/10.3390/diagnostics11010079 10.3390/diagnostics11010079 Search in Google Scholar

Nordmann P, Poirel L, Walsh TR, Livermore DM. The emerging NDM carbapenemases. Trends Microbiol. 2011 Dec;19(12):588–595. https://doi.org/10.1016/j.tim.2011.09.005 NordmannP PoirelL WalshTR LivermoreDM The emerging NDM carbapenemases Trends Microbiol 2011 Dec 19 12 588 595 https://doi.org/10.1016/j.tim.2011.09.005 10.1016/j.tim.2011.09.005 Search in Google Scholar

Patro LPP, Sudhakar KU, Rathinavelan T. K-PAM: a unified platform to distinguish Klebsiella species K- and O-antigen types, model antigen structures and identify hypervirulent strains. Sci Rep. 2020 Dec;10(1):16732. https://doi.org/10.1038/s41598-020-73360-1 PatroLPP SudhakarKU RathinavelanT K-PAM: a unified platform to distinguish Klebsiella species K- and O-antigen types, model antigen structures and identify hypervirulent strains Sci Rep 2020 Dec 10 1 16732 https://doi.org/10.1038/s41598-020-73360-1 10.1038/s41598-020-73360-1 Search in Google Scholar

Ragupathi NKD, Sethuvel DPM, Anandan S, Murugan D, Asokan K, Neethi Mohan RG, Vasudevan K, D TK, C GPD, Veeraraghavan B. First hybrid complete genome of Aeromonas veronii reveals chromosome-mediated novel structural variant mcr-3.30 from a human clinical sample. Access Microbiol. 2020 Feb 17;2(4): acmi000103. https://doi.org/10.1099/acmi.0.000103 RagupathiNKD SethuvelDPM AnandanS MuruganD AsokanK Neethi MohanRG VasudevanK DTK CGPD VeeraraghavanB First hybrid complete genome of Aeromonas veronii reveals chromosome-mediated novel structural variant mcr-3.30 from a human clinical sample Access Microbiol 2020 Feb 17 2 4 acmi000103. https://doi.org/10.1099/acmi.0.000103 10.1099/acmi.0.000103 Search in Google Scholar

Ramadan H, Gupta SK, Sharma P, Ahmed M, Hiott LM, Barrett JB, Woodley TA, Frye JG, Jackson CR. Circulation of emerging NDM-5-producing Escherichia coli among humans and dogs in Egypt. Zoonoses Public Health. 2020 May;67(3):324–329. https://doi.org/10.1111/zph.12676 RamadanH GuptaSK SharmaP AhmedM HiottLM BarrettJB WoodleyTA FryeJG JacksonCR Circulation of emerging NDM-5-producing Escherichia coli among humans and dogs in Egypt Zoonoses Public Health 2020 May 67 3 324 329 https://doi.org/10.1111/zph.12676 10.1111/zph.12676 Search in Google Scholar

Rocha IV, dos Santos Silva N, das Neves Andrade CA, de Lacerda Vidal CF, Leal NC, Xavier DE. Diverse and emerging molecular mechanisms award polymyxins resistance to Enterobacteriaceae clinical isolates from a tertiary hospital of Recife, Brazil. Infect Genet Evol. 2020 Nov;85:104584. https://doi.org/10.1016/j.meegid.2020.104584 RochaIV dos Santos SilvaN das Neves AndradeCA de Lacerda VidalCF LealNC XavierDE Diverse and emerging molecular mechanisms award polymyxins resistance to Enterobacteriaceae clinical isolates from a tertiary hospital of Recife, Brazil Infect Genet Evol 2020 Nov 85 104584. https://doi.org/10.1016/j.meegid.2020.104584 10.1016/j.meegid.2020.104584 Search in Google Scholar

Sadek M, Nariya H, Shimamoto T, Kayama S, Yu L, Hisatsune J, Sugai M, Nordmann P, Poirel L, Shimamoto T. First genomic characterization of blaVIM-1 and mcr-9-coharbouring Enterobacter hormaechei isolated from food of animal origin. Pathogens. 2020a Aug 22;9(9):687. https://doi.org/10.3390/pathogens9090687 SadekM NariyaH ShimamotoT KayamaS YuL HisatsuneJ SugaiM NordmannP PoirelL ShimamotoT First genomic characterization of blaVIM-1 and mcr-9-coharbouring Enterobacter hormaechei isolated from food of animal origin Pathogens 2020a Aug 22 9 9 687 https://doi.org/10.3390/pathogens9090687 10.3390/pathogens9090687 Search in Google Scholar

Sadek M, Ortiz de la Rosa JM, Abdelfattah Maky M, Korashe Dandrawy M, Nordmann P, Poirel L. Genomic features of MCR-1 and extended-spectrum β-lactamase-producing Enterobacterales from retail raw chicken in Egypt. Microorganisms. 2021 Jan 19; 9(1):195. https://doi.org/10.3390/microorganisms9010195 SadekM Ortiz de la RosaJM Abdelfattah MakyM Korashe DandrawyM NordmannP PoirelL Genomic features of MCR-1 and extended-spectrum β-lactamase-producing Enterobacterales from retail raw chicken in Egypt Microorganisms 2021 Jan 19 9 1 195 https://doi.org/10.3390/microorganisms9010195 10.3390/microorganisms9010195 Search in Google Scholar

Sadek M, Poirel L, Nordmann P, Nariya H, Shimamoto T, Shimamoto T. Draft genome sequence of an mcr-1/IncI2-carrying multidrug-resistant Escherichia coli B1:ST101 isolated from meat and meat products in Egypt. J Glob Antimicrob Resist. 2020b Mar; 20:41–42. https://doi.org/10.1016/j.jgar.2019.11.015 SadekM PoirelL NordmannP NariyaH ShimamotoT ShimamotoT Draft genome sequence of an mcr-1/IncI2-carrying multidrug-resistant Escherichia coli B1:ST101 isolated from meat and meat products in Egypt J Glob Antimicrob Resist 2020b Mar 20 41 42 https://doi.org/10.1016/j.jgar.2019.11.015 10.1016/j.jgar.2019.11.015 Search in Google Scholar

Sayyahfar S, Choobdar FA, Mashayekhi M, Jazi FM. Successful management of pan-resistant Acinetobacter baumannii meningitis without intrathecal or intraventricular antibiotic therapy in a neonate. Infect Chemother. 2021;53(1):146–150. https://doi.org/10.3947/ic.2020.0202 SayyahfarS ChoobdarFA MashayekhiM JaziFM Successful management of pan-resistant Acinetobacter baumannii meningitis without intrathecal or intraventricular antibiotic therapy in a neonate Infect Chemother 2021 53 1 146 150 https://doi.org/10.3947/ic.2020.0202 10.3947/ic.2020.0202 Search in Google Scholar

Singh S, Pathak A, Rahman M, Singh A, Nag S, Sahu C, Prasad KN. Genetic characterisation of colistin resistant Klebsiella pneumoniae clinical isolates from North India. Front Cell Infect Microbiol. 2021 Jun 21;11:666030. https://doi.org/10.3389/fcimb.2021.666030 SinghS PathakA RahmanM SinghA NagS SahuC PrasadKN Genetic characterisation of colistin resistant Klebsiella pneumoniae clinical isolates from North India Front Cell Infect Microbiol 2021 Jun 21 11 666030. https://doi.org/10.3389/fcimb.2021.666030 10.3389/fcimb.2021.666030 Search in Google Scholar

Soliman AM, Maruyama F, Zarad HO, Ota A, Nariya H, Shimamoto T, Shimamoto T. Emergence of a multidrug-resistant Enterobacter hormaechei clinical isolate from Egypt co-harboring mcr-9 and blaVIM-4. Microorganisms. 2020a Apr 20;8(4):595. https://doi.org/10.3390/microorganisms8040595 SolimanAM MaruyamaF ZaradHO OtaA NariyaH ShimamotoT ShimamotoT Emergence of a multidrug-resistant Enterobacter hormaechei clinical isolate from Egypt co-harboring mcr-9 and blaVIM-4 Microorganisms 2020a Apr 20 8 4 595 https://doi.org/10.3390/microorganisms8040595 10.3390/microorganisms8040595 Search in Google Scholar

Soliman AM, Ramadan H, Zarad H, Sugawara Y, Yu L, Sugai M, Shimamoto T, Hiott LM, Frye JG, Jackson CR, et al. Coproduction of tet(X7) conferring high-level tigecycline resistance, fosfomycin fosa4, and colistin mcr-1.1 in Escherichia coli strains from chickens in Egypt. Antimicrob Agents Chemother. 2021 May 18; 65(6): e02084-20. https://doi.org/10.1128/AAC.02084-20 SolimanAM RamadanH ZaradH SugawaraY YuL SugaiM ShimamotoT HiottLM FryeJG JacksonCR Coproduction of tet(X7) conferring high-level tigecycline resistance, fosfomycin fosa4, and colistin mcr-1.1 in Escherichia coli strains from chickens in Egypt Antimicrob Agents Chemother 2021 May 18 65 6 e02084-20. https://doi.org/10.1128/AAC.02084-20 10.1128/AAC.02084-20 Search in Google Scholar

Soliman AM, Zarad HO, Nariya H, Shimamoto T, Shimamoto T. Genetic analysis of carbapenemase-producing Gram-negative bacteria isolated from a university teaching hospital in Egypt. Infect Genet Evol. 2020b Jan;77:104065. https://doi.org/10.1016/j.meegid.2019.104065 SolimanAM ZaradHO NariyaH ShimamotoT ShimamotoT Genetic analysis of carbapenemase-producing Gram-negative bacteria isolated from a university teaching hospital in Egypt Infect Genet Evol 2020b Jan 77 104065. https://doi.org/10.1016/j.meegid.2019.104065 10.1016/j.meegid.2019.104065 Search in Google Scholar

Sun J, Zhang H, Liu YH, Feng Y. Towards understanding MCR-like colistin resistance. Trends Microbiol. 2018 Sep;26(9):794–808. https://doi.org/10.1016/j.tim.2018.02.006 SunJ ZhangH LiuYH FengY Towards understanding MCR-like colistin resistance Trends Microbiol 2018 Sep 26 9 794 808 https://doi.org/10.1016/j.tim.2018.02.006 10.1016/j.tim.2018.02.006 Search in Google Scholar

Terveer EM, Nijhuis RHT, Crobach MJT, Knetsch CW, Veldkamp KE, Gooskens J, Kuijper EJ, Claas ECJ. Prevalence of colistin resistance gene (mcr-1) containing Enterobacteriaceae in feces of patients attending a tertiary care hospital and detection of a mcr-1 containing, colistin susceptible E. coli. PLoS One. 2017 Jun 2;12(6): e0178598. https://doi.org/10.1371/journal.pone.0178598 TerveerEM NijhuisRHT CrobachMJT KnetschCW VeldkampKE GooskensJ KuijperEJ ClaasECJ Prevalence of colistin resistance gene (mcr-1) containing Enterobacteriaceae in feces of patients attending a tertiary care hospital and detection of a mcr-1 containing, colistin susceptible E. coli PLoS One 2017 Jun 2 12 6 e0178598. https://doi.org/10.1371/journal.pone.0178598 10.1371/journal.pone.0178598 Search in Google Scholar

Turton JF, Perry C, Elgohari S, Hampton CV. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J Med Microbiol. 2010 May 01;59(5):541–547. https://doi.org/10.1099/jmm.0.015198-0 TurtonJF PerryC ElgohariS HamptonCV PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets J Med Microbiol 2010 May 01 59 5 541 547 https://doi.org/10.1099/jmm.0.015198-0 10.1099/jmm.0.015198-0 Search in Google Scholar

Wang C, Feng Y, Liu L, Wei L, Kang M, Zong Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg Microbes Infect. 2020a Jan 01;9(1):508–516. https://doi.org/10.1080/22221751.2020.1732231 WangC FengY LiuL WeiL KangM ZongZ Identification of novel mobile colistin resistance gene mcr-10 Emerg Microbes Infect 2020a Jan 01 9 1 508 516 https://doi.org/10.1080/22221751.2020.1732231 10.1080/22221751.2020.1732231 Search in Google Scholar

Wang CH, Hsieh YH, Powers ZM, Kao CY. Defeating antibiotic-resistant bacteria: exploring alternative therapies for a post-antibiotic era. Int J Mol Sci. 2020b Feb 05;21(3):1061. https://doi.org/10.3390/ijms21031061 WangCH HsiehYH PowersZM KaoCY Defeating antibiotic-resistant bacteria: exploring alternative therapies for a post-antibiotic era Int J Mol Sci 2020b Feb 05 21 3 1061 https://doi.org/10.3390/ijms21031061 10.3390/ijms21031061 Search in Google Scholar

Wang L, Gu H, Lu X. A rapid low-cost real-time PCR for the detection of Klebsiella pneumonia carbapenemase genes. Ann Clin Microbiol Antimicrob. 2012 Jan;11(1):9. https://doi.org/10.1186/1476-0711-11-9 WangL GuH LuX A rapid low-cost real-time PCR for the detection of Klebsiella pneumonia carbapenemase genes Ann Clin Microbiol Antimicrob 2012 Jan 11 1 9 https://doi.org/10.1186/1476-0711-11-9 10.1186/1476-0711-11-9 Search in Google Scholar

Wang Y, Tian GB, Zhang R, Shen Y, Tyrrell JM, Huang X, Zhou H, Lei L, Li HY, Doi Y, et al. Prevalence, risk factors, outcomes, and molecular epidemiology of mcr-1-positive Enterobacteriaceae in patients and healthy adults from China: an epidemiological and clinical study. Lancet Infect Dis. 2017 Apr;17(4):390–399. https://doi.org/10.1016/S1473-3099(16)30527-8 WangY TianGB ZhangR ShenY TyrrellJM HuangX ZhouH LeiL LiHY DoiY Prevalence, risk factors, outcomes, and molecular epidemiology of mcr-1-positive Enterobacteriaceae in patients and healthy adults from China: an epidemiological and clinical study Lancet Infect Dis 2017 Apr 17 4 390 399 https://doi.org/10.1016/S1473-3099(16)30527-8 10.1016/S1473-3099(16)30527-8 Search in Google Scholar

Xu Y, Chen H, Zhang H, Ullah S, Hou T, Feng Y. The MCR-3 inside linker appears as a facilitator of colistin resistance. Cell Rep. 2021 May;35(7):109135. https://doi.org/10.1016/j.celrep.2021.109135 XuY ChenH ZhangH UllahS HouT FengY The MCR-3 inside linker appears as a facilitator of colistin resistance Cell Rep 2021 May 35 7 109135. https://doi.org/10.1016/j.celrep.2021.109135 10.1016/j.celrep.2021.109135 Search in Google Scholar

Yanat B, Machuca J, Yahia RD, Touati A, Pascual Á, Rodríguez-Martínez JM. First report of the plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate in Algeria. Int J Antimicrob Agents. 2016 Dec;48(6):760–761. https://doi.org/10.1016/j.ijantimicag.2016.09.003 YanatB MachucaJ YahiaRD TouatiA PascualÁ Rodríguez-MartínezJM First report of the plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate in Algeria Int J Antimicrob Agents 2016 Dec 48 6 760 761 https://doi.org/10.1016/j.ijantimicag.2016.09.003 10.1016/j.ijantimicag.2016.09.003 Search in Google Scholar

Yuan J, Wang X, Shi D, Ge Q, Song X, Hu W, Wei D, Ge C, Li X, Hu C. Extensive antimicrobial resistance and plasmid-carrying resistance genes in mcr-1-positive E. coli sampled in swine, in Guangxi, South China. BMC Vet Res. 2021 Dec;17(1):86. https://doi.org/10.1186/s12917-021-02758-4 YuanJ WangX ShiD GeQ SongX HuW WeiD GeC LiX HuC Extensive antimicrobial resistance and plasmid-carrying resistance genes in mcr-1-positive E. coli sampled in swine, in Guangxi, South China BMC Vet Res. 2021 Dec 17 1 86 https://doi.org/10.1186/s12917-021-02758-4 10.1186/s12917-021-02758-4 Search in Google Scholar

Zafer MM, El-Mahallawy HA, Abdulhak A, Amin MA, Al-Agamy MH, Radwan HH. Emergence of colistin resistance in multidrug-resistant Klebsiella pneumoniae and Escherichia coli strains isolated from cancer patients. Ann Clin Microbiol Antimicrob. 2019 Dec;18(1):40. https://doi.org/10.1186/s12941-019-0339-4 ZaferMM El-MahallawyHA AbdulhakA AminMA Al-AgamyMH RadwanHH Emergence of colistin resistance in multidrug-resistant Klebsiella pneumoniae and Escherichia coli strains isolated from cancer patients Ann Clin Microbiol Antimicrob 2019 Dec 18 1 40 https://doi.org/10.1186/s12941-019-0339-4 10.1186/s12941-019-0339-4 Search in Google Scholar

Zakaria AS, Edward EA, Mohamed NM. Genomic insights into a colistin-resistant uropathogenic Escherichia coli strain of O23:H4-ST641 lineage harboring mcr-1.1 on a conjugative IncHI2 plasmid from Egypt. Microorganisms. 2021 Apr 10;9(4):799. https://doi.org/10.3390/microorganisms9040799 ZakariaAS EdwardEA MohamedNM Genomic insights into a colistin-resistant uropathogenic Escherichia coli strain of O23:H4-ST641 lineage harboring mcr-1.1 on a conjugative IncHI2 plasmid from Egypt Microorganisms 2021 Apr 10 9 4 799 https://doi.org/10.3390/microorganisms9040799 10.3390/microorganisms9040799 Search in Google Scholar

Zhou K, Luo Q, Wang Q, Huang C, Lu H, Rossen JWA, Xiao Y, Li L. Silent transmission of an IS1294b-deactivated mcr-1 gene with inducible colistin resistance. Int J Antimicrob Agents. 2018 Jun; 51(6):822–828. https://doi.org/10.1016/j.ijantimicag.2018.01.004 ZhouK LuoQ WangQ HuangC LuH RossenJWA XiaoY LiL Silent transmission of an IS1294b-deactivated mcr-1 gene with inducible colistin resistance Int J Antimicrob Agents 2018 Jun 51 6 822 828 https://doi.org/10.1016/j.ijantimicag.2018.01.004 10.1016/j.ijantimicag.2018.01.004 Search in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo